Wow! My brain explodes. Not in a bad way, you understand. In a good way. Stuart Robinson (who is he?) goes live with his weblog. How can he know about so much good stuff that I have missed?
Stu's Weblog:Posted by DeLong at May 20, 2003 03:24 PM | TrackBack
- I’m still not convinced choosing blosxom over Movable Type was wise. But the plugins rock and at least RMS won’t hunt me down.
- Corporate computer security consulting still sucks? Interesting idea from Charlie Stross.
- EasyCinema: EasyJet’s Stelios Haji-Ioannou pushes his yield management techniques into the cinema industry.
- New wifi cards work on any frequency = no Linux drivers: This gives us a preview of the major shitstorm that software radio is going to cause.
- South Korea: a futurologist’s wet dream: Want to see what 70% broadband adoption does to a society? Korea tells you
- Microsoft licenses Unix IP from SCO: Coincidentally at the same time as SCO are suing IBM to stop Linux. Microsoft are a company capable of learning and adapting. What they learnt from the antitrust trial seems to be ‘get someone else to do your dirty work’.
- You can take my money but you can’t take my grades: Sometimes D-Squared is good... and sometimes he’s awesome
- LifeLog, from the people who brought you ARPANET: This project appears to be an attempt to create the kind of intelligence computers will need to be able to make sense of all the data of an individual’s life. The ultimate PA and PH (personal historian).
- That IBM ad where the guy in the trenchcoat looks like he’s shoplifting but is actually paying wirelessly (hoho!) is now more than an ad.
- Interesting. How long until “x years blogging experience” appears on job adverts?
- WiFi phones in use: Fortune article titled “This Is Not a Cellphone”.
- Cuba was part of the developed world in 1957: Brad DeLong offers excellent counterpoints to those who have (economically - at least) tried to give Castro some credit.
- Apple’s backdoor napster clone: The theory is that Apple intentionally made iTunes transparent enough that semi-legal file sharing systems could be built around it. Hopefully sidestepping legal problems.
- Romero developing for the N-Gage: Slashdot brings news from E3 that Doom and Quake co-creator John Romero is developing for Nokia’s new gaming oriented phone.
- IT goes golden or grey? Interesting Economist article about IT leaving it’s exponential roots behind and ‘just working’. I read somewhere that this is actually regurgitated Oracle PR but I’m a sucker for slick historic parallels, so:
- Amazon.com actually very healthy: Damn, while I was waiting for them to die, Bezos was doing a really good job sorting them out.
- Sub-City Tunnelling : Here’s something from last month’s Wired that I missed. The emergence of tunnelling technologies that appear to make underground suburbs (underburbs?) economically inevitable.
- Stanford’s 1k page/hr book scanning robot: Fantastic milestone on the way to universal digitisation of the world’s knowledge.
- Closet fark photoshopper interviewed: Former Los Angeles Times photographer Brian Walski is interviewed about his fake Iraq war photo.
- Source to commercial album available: I dislike old man rock as much as anyone my age, but Marillion are showing us a fleeting glimse of a more open music production method.
- Decentralised security camera watching: Another sighting of the transparent society on the horizon.
- Social skills first developed to enable large game hunting: Meat eating as the basis of civilisation. Vegetarians declared 'Untrustworthy'.
- What happens when the future starts to evenly distribute? Pre-natal scans look set to - in the long-term - indirectly solve India’s overpopulation and women’s rights problems.
- BBC continues to defy logic by being good: BBC shows interest in becoming enabler in addition to broadcaster.
- Stalinesque photoshopping in Evening Standard: Sometimes, the anachronisms come from the wrong direction.
- SARS 1.0 Released: Today’s head fuck: being able to download the sequenced SARS genome: ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTG
- Iranians blog for freedom: Looks like Iran could be the first country to geek it to freedom.
- Big Brother prefers WiFi: The Transparent Society gets closer. How long before those CCTV WiFi signals become hacked? How long before people realise they are better off without a state monopoly on snooping?
- Open Code and Free Speech: So where is the benefit for non-programmers? A slightly bizarre comparision I like is to a mute man choosing which country he should claim asylum in. He can’t speak so what use is freedom of speech to him? Others will speak for him, helping to ensure his liberty. Others will audit code for you, helping to ensure your security.
- The dragon and the crack screen: ... the wonderful first article of Mark Pilgrim.
The "civilization came from meat-eating" piece is a throwaway. No new information or analysis that I could see. Group hunting has always been thought to be part of the impetus to culture-development, and it's been known for a long time that hunting/gathering preceded agriculture.
Awhile back there was a theory that beer-drinking at ritual events was the main impetus to urbanization. I like that one. My own theory that the opposable thumb was first developed for the purpose of masturbation has not receieved wide support, but watch the chimps at the zoo sometime.
Posted by: zizka on May 20, 2003 07:13 PMThank you for the kind words.
I'll try to get an 'about' page up, the apparent anonymity is just from a lack of time. Abridged: British, based in Oxford, not at 'Oxford', soon to graduate. Reads too much.
Posted by: Stuart Robinson on May 20, 2003 08:12 PMThank you for the kind words.
I'll try to get an 'about' page up, the apparent anonymity is just from a lack of time. Abridged: British, based in Oxford, not at 'Oxford', soon to graduate. Reads too much.
Posted by: Stuart Robinson on May 20, 2003 08:14 PMThank you for the kind words.
I'll try to get an 'about' page up, the apparent anonymity is just from a lack of time. Abridged: British, based in Oxford, not at 'Oxford', soon to graduate. Reads too much.
Posted by: Stuart Robinson on May 20, 2003 08:16 PMThank you for the kind words.
I'll try to get an 'about' page up, the apparent anonymity is just from a lack of time. Abridged: British, based in Oxford, not at 'Oxford', soon to graduate. Reads too much.
Posted by: Stuart Robinson on May 20, 2003 08:18 PMSorry. I won't try to post comments with Galeon again.
Posted by: Stuart Robinson on May 20, 2003 08:42 PMHow is the BBC being good defying logic?
Posted by: David Weman (Europundit) on May 21, 2003 11:03 AM//
How is the BBC being good defying logic?
//
is not the BBC a public corporation?
DSW
Posted by: Antoni Jaume on May 21, 2003 12:19 PM